Back to results

Old Dominion University

Cloning a Putative DNA-Binding Protein Controlling the 5'LTR of the Copia Element in Drosophila

Abstract

dc:description.abstract

<p>Copia, a Drosophila retrotransposon, is constitutively expressed in all developmental stages, except the embryo in <em>Drosophila melanogaster</em>. The effect of random integration of the copia element results in phenotypic change in Drosophila. The regulatory sequences, controlling copia expression, are located within the 5'LTR. The DNA sequence in the 5'LTR and in the location between downstream of entire the 5' LTR and the initial translation site have been identified by mobilityshift binding assays and DNase I footprinting assays. The data reveals three protected regions: a TATA-binding site, the AT-1, and AT-2 binding sites. The TATA-binding site and AT-1 site are located within the 5'LTR, while the AT-2 sites is located within the 5'UTR of copia element. The sequence protected by the AT-1 protein is ACTATTTATTTATTTATTAGAAAGG, (25'bp), located between nucleotides 227 and 252.</p> <p>The AT-1 protein has a candidate region possessing a transactivation domain. No strong similarity in DNA sequence to known DNA-binding motifs was found in the AT-1 sequence. The amino acid sequence of the AT-1 protein, however, carries a high percentage of positively charged amino acids, consistent with a DNA-binding function for the AT-1 protein.</p>

Degree

thesis:*
Name thesis:degree_name
Doctor of Philosophy (PhD)
Level thesis:degree_level
Dissertation
Discipline thesis:degree_discipline
Chemistry and Biochemistry
Year dc:date.available
1993

Author and committee

dc:creator, dc:contributor.*
Author dc:creator
  • Kan, Horng-Yuan
Contributors dc:contributor
  • Christopher J. Osgood
  • Frank J. Castora
  • Mark S. Elliot
  • Timothy J. Bos

Subjects

dc:subject × 5

Identifiers

dc:identifier.*

Chain of custody

source
Harvested from
Old Dominion University
Base URL
digitalcommons.odu.edu/do/oai/
Last updated
2026-07-24
Source record
OAI-PMH GetRecord
citation

Kan, Horng-Yuan. Cloning a Putative DNA-Binding Protein Controlling the 5'LTR of the Copia Element in Drosophila. Dissertation thesis, 1993. https://digitalcommons.odu.edu/biomedicalsciences_etds/114