Copia, a Drosophila retrotransposon, is constitutively expressed in all developmental stages, except the embryo in Drosophila melanogaster. The effect of random integration of the copia element results in phenotypic change in Drosophila. The regulatory sequences, controlling copia expression, are located within the 5'LTR. The DNA sequence in the 5'LTR and in the location between downstream of entire the 5' LTR and the initial translation site have been identified by mobilityshift binding assays and DNase I footprinting assays. The data reveals three protected regions: a TATA-binding site, the AT-1, and AT-2 binding sites. The TATA-binding site and AT-1 site are located within the 5'LTR, while the AT-2 sites is located within the 5'UTR of copia element. The sequence protected by the AT-1 protein is ACTATTTATTTATTTATTAGAAAGG, (25'bp), located between nucleotides 227 and 252.
The AT-1 protein has a candidate region possessing a transactivation domain. No strong similarity in DNA sequence to known DNA-binding motifs was found in the AT-1 sequence. The amino acid sequence of the AT-1 protein, however, carries a high percentage of positively charged amino acids, consistent with a DNA-binding function for the AT-1 protein.
","abstract_html":"<p>Copia, a Drosophila retrotransposon, is constitutively expressed in all developmental stages, except the embryo in <em>Drosophila melanogaster</em>. The effect of random integration of the copia element results in phenotypic change in Drosophila. The regulatory sequences, controlling copia expression, are located within the 5'LTR. The DNA sequence in the 5'LTR and in the location between downstream of entire the 5' LTR and the initial translation site have been identified by mobilityshift binding assays and DNase I footprinting assays. The data reveals three protected regions: a TATA-binding site, the AT-1, and AT-2 binding sites. The TATA-binding site and AT-1 site are located within the 5'LTR, while the AT-2 sites is located within the 5'UTR of copia element. The sequence protected by the AT-1 protein is ACTATTTATTTATTTATTAGAAAGG, (25'bp), located between nucleotides 227 and 252.</p> <p>The AT-1 protein has a candidate region possessing a transactivation domain. No strong similarity in DNA sequence to known DNA-binding motifs was found in the AT-1 sequence. The amino acid sequence of the AT-1 protein, however, carries a high percentage of positively charged amino acids, consistent with a DNA-binding function for the AT-1 protein.</p>","abstract_has_math":false,"creators":["Kan, Horng-Yuan"],"institution":null,"degree_name":"Doctor of Philosophy (PhD)","degree_level":"Dissertation","degree_discipline":"Chemistry and Biochemistry","degree_department":null,"school":null,"contributors":["Christopher J. Osgood","Frank J. Castora","Mark S. Elliot","Timothy J. Bos"],"advisors":[],"committee_chairs":[],"committee_members":[],"year":1993,"date_issued":"1993-03-31T08:00:00Z","date_published":"1993-03-31T08:00:00Z","updated_at":"2026-07-24T03:35:08Z","subjects":["Copia","DNA-binding protein","Drosophila","Cloning","Molecular Biology"],"languages":[],"rights":[],"rights_urls":[],"identifier_entries":[]},"links":{"outbound_url":"https://digitalcommons.odu.edu/biomedicalsciences_etds/114","outbound_label":"Repository record","outbound_source":"dc:identifier"},"metadata_groups":[{"id":"people","label":"People","entries":[{"key":"dc:contributor","label":"Contributor","values":["Christopher J. Osgood","Frank J. Castora","Mark S. Elliot","Timothy J. Bos"]},{"key":"dc:creator","label":"Author","values":["Kan, Horng-Yuan"]}]},{"id":"academic_context","label":"Academic Context","entries":[{"key":"dc:date.available","label":"Dc Date Available","values":["2019-09-24T07:00:00Z"]},{"key":"thesis:degree_discipline","label":"Discipline","values":["Chemistry and Biochemistry"]},{"key":"thesis:degree_level","label":"Degree Level","values":["Dissertation"]},{"key":"thesis:degree_name","label":"Degree Name","values":["Doctor of Philosophy (PhD)"]}]},{"id":"subjects_keywords","label":"Subjects and Keywords","entries":[{"key":"dc:subject","label":"Dc Subject","values":["Copia","DNA-binding protein","Drosophila","Cloning","Molecular Biology"]}]},{"id":"identifiers","label":"Identifiers","entries":[{"key":"dc:identifier","label":"Identifier","values":["https://digitalcommons.odu.edu/biomedicalsciences_etds/114"]}]},{"id":"additional","label":"Additional Metadata","entries":[{"key":"dc:description.abstract","label":"Abstract","values":["Copia, a Drosophila retrotransposon, is constitutively expressed in all developmental stages, except the embryo in Drosophila melanogaster. The effect of random integration of the copia element results in phenotypic change in Drosophila. The regulatory sequences, controlling copia expression, are located within the 5'LTR. The DNA sequence in the 5'LTR and in the location between downstream of entire the 5' LTR and the initial translation site have been identified by mobilityshift binding assays and DNase I footprinting assays. The data reveals three protected regions: a TATA-binding site, the AT-1, and AT-2 binding sites. The TATA-binding site and AT-1 site are located within the 5'LTR, while the AT-2 sites is located within the 5'UTR of copia element. The sequence protected by the AT-1 protein is ACTATTTATTTATTTATTAGAAAGG, (25'bp), located between nucleotides 227 and 252.
The AT-1 protein has a candidate region possessing a transactivation domain. No strong similarity in DNA sequence to known DNA-binding motifs was found in the AT-1 sequence. The amino acid sequence of the AT-1 protein, however, carries a high percentage of positively charged amino acids, consistent with a DNA-binding function for the AT-1 protein.
"]},{"key":"dc:title","label":"Title","values":["Cloning a Putative DNA-Binding Protein Controlling the 5'LTR of the Copia Element in Drosophila"]}]}],"canonical_facts":{"dc:contributor":["Christopher J. Osgood","Frank J. Castora","Mark S. Elliot","Timothy J. Bos"],"dc:creator":["Kan, Horng-Yuan"],"dc:date.available":["2019-09-24T07:00:00Z"],"dc:description.abstract":["Copia, a Drosophila retrotransposon, is constitutively expressed in all developmental stages, except the embryo in Drosophila melanogaster. The effect of random integration of the copia element results in phenotypic change in Drosophila. The regulatory sequences, controlling copia expression, are located within the 5'LTR. The DNA sequence in the 5'LTR and in the location between downstream of entire the 5' LTR and the initial translation site have been identified by mobilityshift binding assays and DNase I footprinting assays. The data reveals three protected regions: a TATA-binding site, the AT-1, and AT-2 binding sites. The TATA-binding site and AT-1 site are located within the 5'LTR, while the AT-2 sites is located within the 5'UTR of copia element. The sequence protected by the AT-1 protein is ACTATTTATTTATTTATTAGAAAGG, (25'bp), located between nucleotides 227 and 252.
The AT-1 protein has a candidate region possessing a transactivation domain. No strong similarity in DNA sequence to known DNA-binding motifs was found in the AT-1 sequence. The amino acid sequence of the AT-1 protein, however, carries a high percentage of positively charged amino acids, consistent with a DNA-binding function for the AT-1 protein.
"],"dc:identifier":["https://digitalcommons.odu.edu/biomedicalsciences_etds/114"],"dc:subject":["Copia","DNA-binding protein","Drosophila","Cloning","Molecular Biology"],"dc:title":["Cloning a Putative DNA-Binding Protein Controlling the 5'LTR of the Copia Element in Drosophila"],"thesis:degree_discipline":["Chemistry and Biochemistry"],"thesis:degree_level":["Dissertation"],"thesis:degree_name":["Doctor of Philosophy (PhD)"]},"updated_at":"2026-07-24T03:35:08Z"}