{"id":{"repo_id":"uiuc","oai_identifier":"oai:www.ideals.illinois.edu:2142/23079"},"canonical_url":"https://search.dev.ndltd.org/etd/uiuc/oai:www.ideals.illinois.edu:2142/23079","repository":{"repo_id":"uiuc","name":"University of Illinois - Urbana-Champaign","base_url":"https://www.ideals.illinois.edu/oai-pmh"},"display":{"title":"Molecular characterization and promoter analysis of the maize cytosolic glyceraldehyde 3-phosphate dehydrogenase gene family","abstract":"The response of maize (Zea mays L.) roots to oxygen deprivation involves an altered gene expression and protein synthesis. Maize cytosolic glyceraldehyde-3-phosphate dehydrogenase (GAPDH) has been identified as one of the anaerobic polypeptides and mRNAs corresponding to a member of the gpc multi-gene family, gpc3, increase under anaerobiosis. This study extends further analysis of the gpc gene family, with specific emphasis on gpc4. Analysis of full length cDNA clones for GAPC2, GAPC3 and GAPC4 revealed that the deduced amino acid sequence of GAPC4 has 99.4% identity with the GAPC3 cDNA clone as compared to only 81% with either GAPC1 or GAPC2. Northern blot analysis revealed a maximum transcript accumulation 24 h after anaerobiosis and anoxic specific induced expression for gpc3 and gpc4.","abstract_html":"The response of maize (Zea mays L.) roots to oxygen deprivation involves an altered gene expression and protein synthesis. Maize cytosolic glyceraldehyde-3-phosphate dehydrogenase (GAPDH) has been identified as one of the anaerobic polypeptides and mRNAs corresponding to a member of the gpc multi-gene family, gpc3, increase under anaerobiosis. This study extends further analysis of the gpc gene family, with specific emphasis on gpc4. Analysis of full length cDNA clones for GAPC2, GAPC3 and GAPC4 revealed that the deduced amino acid sequence of GAPC4 has 99.4% identity with the GAPC3 cDNA clone as compared to only 81% with either GAPC1 or GAPC2. Northern blot analysis revealed a maximum transcript accumulation 24 h after anaerobiosis and anoxic specific induced expression for gpc3 and gpc4.","abstract_has_math":false,"creators":["Manjunath, Sivalinganna"],"institution":"University of Illinois at Urbana-Champaign","degree_name":"Ph.D.","degree_level":"Dissertation","degree_discipline":"Agronomy","degree_department":null,"school":null,"contributors":["Sachs, Martin M."],"advisors":[],"committee_chairs":[],"committee_members":[],"year":2011,"date_issued":"2011-05-07T14:01:25Z","date_published":"2011-05-07T14:01:25Z","updated_at":"2026-07-22T22:25:21Z","subjects":["Agriculture, Agronomy","Biology, Molecular","Biology, Genetics"],"languages":["eng"],"rights":["Copyright 1996 Manjunath, Sivalinganna"],"rights_urls":[],"identifier_entries":[{"key":"dc:identifier","label":"Identifier","values":["AAI9624426","(UMI)AAI9624426"],"render_values":[{"text":"AAI9624426","href":null,"code":true},{"text":"(UMI)AAI9624426","href":null,"code":true}]}]},"links":{"outbound_url":"http://hdl.handle.net/2142/23079","outbound_label":"Handle","outbound_source":"dc:identifier"},"metadata_groups":[{"id":"people","label":"People","entries":[{"key":"dc:contributor","label":"Contributor","values":["Sachs, Martin M."]},{"key":"dc:creator","label":"Author","values":["Manjunath, Sivalinganna"]}]},{"id":"academic_context","label":"Academic Context","entries":[{"key":"dc:date","label":"Dc Date","values":["2011-05-07T14:01:25Z","10000-01-01","1996"]},{"key":"dc:type","label":"Dc Type","values":["text"]},{"key":"thesis:degree_discipline","label":"Discipline","values":["Agronomy"]},{"key":"thesis:degree_level","label":"Degree Level","values":["Dissertation"]},{"key":"thesis:degree_name","label":"Degree Name","values":["Ph.D."]},{"key":"thesis:institution_name","label":"Thesis Institution Name","values":["University of Illinois at Urbana-Champaign"]}]},{"id":"subjects_keywords","label":"Subjects and Keywords","entries":[{"key":"dc:subject","label":"Dc Subject","values":["Agriculture, Agronomy","Biology, Molecular","Biology, Genetics"]}]},{"id":"language_rights","label":"Language and Rights","entries":[{"key":"dc:language","label":"Dc Language","values":["eng"]},{"key":"dc:rights","label":"Dc Rights","values":["Copyright 1996 Manjunath, Sivalinganna"]}]},{"id":"identifiers","label":"Identifiers","entries":[{"key":"dc:identifier","label":"Identifier","values":["AAI9624426","(UMI)AAI9624426","http://hdl.handle.net/2142/23079"]}]},{"id":"additional","label":"Additional Metadata","entries":[{"key":"dc:description","label":"Description","values":["The response of maize (Zea mays L.) roots to oxygen deprivation involves an altered gene expression and protein synthesis. Maize cytosolic glyceraldehyde-3-phosphate dehydrogenase (GAPDH) has been identified as one of the anaerobic polypeptides and mRNAs corresponding to a member of the gpc multi-gene family, gpc3, increase under anaerobiosis. This study extends further analysis of the gpc gene family, with specific emphasis on gpc4. Analysis of full length cDNA clones for GAPC2, GAPC3 and GAPC4 revealed that the deduced amino acid sequence of GAPC4 has 99.4% identity with the GAPC3 cDNA clone as compared to only 81% with either GAPC1 or GAPC2. Northern blot analysis revealed a maximum transcript accumulation 24 h after anaerobiosis and anoxic specific induced expression for gpc3 and gpc4.","The organization of genomic clones of gpc2 and gpc4 is complex in nature with 10 and 11 introns in their coding regions, respectively. The positions of introns are conserved in both gpc2 and gpc4, except for the $\\rm 11\\sp{th}$ intron of gpc4. The upstream regions of gpc2 and gpc4 have eukaryotic features consisting of TATA-box sequence motifs and the transcription start points (TSP) are at 76 and 68 bp upstream of the translation initiation sites, respectively.","Transient expression analysis of GUS activity driven by the gpc4 promoter in maize cell suspension cultures showed an induced expression of approximately three fold over aerobic control, during anaerobiosis. $5\\sp\\prime$-unidirectional deletion analysis of the gpc4 upstream region demonstrated that the critical region required for anoxic induced expression lies between $-$290 and $-$157 bp upstream of the TSP. The critical region identified here has regulatory elements similar to the previously defined maize adh1 and Arabidopsis adh anaerobic response elements as well as the sequences found in other environmentally inducible genes. By an intense review of the sequences required for responses to different external signals, we propose that the sequence of gpc4 from $-$175 to $-$149 (CGCACGTCCTCACGTTTCCGCCCCACC) be defined as a putative Anaerobic Response Complex 1 (ARC1), and between $-$213 to $-$186 ($5\\sp\\prime$-GCCCCGGTCGCGTTTCTCCTCCGGCCCC-$3\\sp\\prime)$ be defined as a putative Anaerobic Response Complex 2 (ARC2).","Made available in DSpace on 2011-05-07T14:01:25Z (GMT). No. of bitstreams: 2 license.txt: 4922 bytes, checksum: 910b249b4beec47e7ab768910c8f966f (MD5) 9624426.pdf: 5879675 bytes, checksum: 9f4ef5bf760c70b6c22582a705574fc5 (MD5) Previous issue date: 1996","Item marked as restricted to the 'UIUC Users [automated]' Group (id=2) by Howard Ding (hding2@illinois.edu) on 2011-05-07T15:02:02Z Item is restricted indefinitely.","Restriction data tranferred 2014-07-01T11:29:28-05:00 Original Data Group with Access UIUC Users [automated] Release Date: none Reason: ETDs are only available to UIUC Users without author permission","Restricted to the U of I community indefinitely during batch ingest of legacy ETDs","U of I Only"]},{"key":"dc:title","label":"Title","values":["Molecular characterization and promoter analysis of the maize cytosolic glyceraldehyde 3-phosphate dehydrogenase gene family"]}]}],"canonical_facts":{"dc:contributor":["Sachs, Martin M."],"dc:creator":["Manjunath, Sivalinganna"],"dc:date":["2011-05-07T14:01:25Z","10000-01-01","1996"],"dc:description":["The response of maize (Zea mays L.) roots to oxygen deprivation involves an altered gene expression and protein synthesis. Maize cytosolic glyceraldehyde-3-phosphate dehydrogenase (GAPDH) has been identified as one of the anaerobic polypeptides and mRNAs corresponding to a member of the gpc multi-gene family, gpc3, increase under anaerobiosis. This study extends further analysis of the gpc gene family, with specific emphasis on gpc4. Analysis of full length cDNA clones for GAPC2, GAPC3 and GAPC4 revealed that the deduced amino acid sequence of GAPC4 has 99.4% identity with the GAPC3 cDNA clone as compared to only 81% with either GAPC1 or GAPC2. Northern blot analysis revealed a maximum transcript accumulation 24 h after anaerobiosis and anoxic specific induced expression for gpc3 and gpc4.","The organization of genomic clones of gpc2 and gpc4 is complex in nature with 10 and 11 introns in their coding regions, respectively. The positions of introns are conserved in both gpc2 and gpc4, except for the $\\rm 11\\sp{th}$ intron of gpc4. The upstream regions of gpc2 and gpc4 have eukaryotic features consisting of TATA-box sequence motifs and the transcription start points (TSP) are at 76 and 68 bp upstream of the translation initiation sites, respectively.","Transient expression analysis of GUS activity driven by the gpc4 promoter in maize cell suspension cultures showed an induced expression of approximately three fold over aerobic control, during anaerobiosis. $5\\sp\\prime$-unidirectional deletion analysis of the gpc4 upstream region demonstrated that the critical region required for anoxic induced expression lies between $-$290 and $-$157 bp upstream of the TSP. The critical region identified here has regulatory elements similar to the previously defined maize adh1 and Arabidopsis adh anaerobic response elements as well as the sequences found in other environmentally inducible genes. By an intense review of the sequences required for responses to different external signals, we propose that the sequence of gpc4 from $-$175 to $-$149 (CGCACGTCCTCACGTTTCCGCCCCACC) be defined as a putative Anaerobic Response Complex 1 (ARC1), and between $-$213 to $-$186 ($5\\sp\\prime$-GCCCCGGTCGCGTTTCTCCTCCGGCCCC-$3\\sp\\prime)$ be defined as a putative Anaerobic Response Complex 2 (ARC2).","Made available in DSpace on 2011-05-07T14:01:25Z (GMT). No. of bitstreams: 2 license.txt: 4922 bytes, checksum: 910b249b4beec47e7ab768910c8f966f (MD5) 9624426.pdf: 5879675 bytes, checksum: 9f4ef5bf760c70b6c22582a705574fc5 (MD5) Previous issue date: 1996","Item marked as restricted to the 'UIUC Users [automated]' Group (id=2) by Howard Ding (hding2@illinois.edu) on 2011-05-07T15:02:02Z Item is restricted indefinitely.","Restriction data tranferred 2014-07-01T11:29:28-05:00 Original Data Group with Access UIUC Users [automated] Release Date: none Reason: ETDs are only available to UIUC Users without author permission","Restricted to the U of I community indefinitely during batch ingest of legacy ETDs","U of I Only"],"dc:identifier":["AAI9624426","(UMI)AAI9624426","http://hdl.handle.net/2142/23079"],"dc:language":["eng"],"dc:rights":["Copyright 1996 Manjunath, Sivalinganna"],"dc:subject":["Agriculture, Agronomy","Biology, Molecular","Biology, Genetics"],"dc:title":["Molecular characterization and promoter analysis of the maize cytosolic glyceraldehyde 3-phosphate dehydrogenase gene family"],"dc:type":["text"],"thesis:degree_discipline":["Agronomy"],"thesis:degree_level":["Dissertation"],"thesis:degree_name":["Ph.D."],"thesis:institution_name":["University of Illinois at Urbana-Champaign"]},"updated_at":"2026-07-22T22:25:21Z"}